Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064792931

From SNPedia
ClinVar
Risk rs1064792931(GCG;GCG)
Alt rs1064792931(GCG;GCG)
Reference Rs1064792931(ACAGATGATGAAAGTATGAAATCGCTATTGCTGCT;ACAGATGATGAAAGTATGAAATCGCTATTGCTGCT)
Significance Pathogenic
Disease Familial cancer of breast
Variation info
Gene BARD1
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000002.11:g.215617214_215617248del35insCGC
CLNSRC
CLNACC RCV000473816.1,