Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064792987

From SNPedia

ClinVar
Risk rs1064792987(-;-)
Alt rs1064792987(-;-)
Reference Rs1064792987(TTGCCACAGGGTAGGAATCTCATTTC;TTGCCACAGGGTAGGAATCTCATTTC)
Significance Probable-Pathogenic
Disease Mitochondrial complex II deficiency Paragangliomas 5
Variation info
Gene SDHA
CLNDBN Mitochondrial complex II deficiency Paragangliomas 5
Reversed 0
HGVS NC_000005.9:g.228440_228465del26
CLNSRC
CLNACC RCV000456955.1,