Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064793001

From SNPedia

ClinVar
Risk rs1064793001(-;-)
Alt rs1064793001(-;-)
Reference Rs1064793001(CGAGCGGCTGGAGCAGGAGCGGGC;CGAGCGGCTGGAGCAGGAGCGGGC)
Significance Pathogenic
Disease Retinitis pigmentosa 78
Variation info
Gene ARHGEF18
CLNDBN Retinitis pigmentosa 78
Reversed 0
HGVS NC_000019.9:g.7532392_7532415del24
CLNSRC OMIM Allelic Variant
CLNACC RCV000477691.1,