Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064793360

From SNPedia

ClinVar
Risk rs1064793360(-;-)
Alt rs1064793360(-;-)
Reference Rs1064793360(CCTTCGAGATCCACGTCCACAGGCGC;CCTTCGAGATCCACGTCCACAGGCGC)
Significance Pathogenic
Disease not provided
Variation info
Gene DAG1
CLNDBN not provided
Reversed 0
HGVS NC_000003.11:g.49569715_49569740del26
CLNSRC
CLNACC RCV000487266.1,