Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064793895

From SNPedia
Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Chromosome2
Position47806581
GeneFBXO11
is asnp
is mentioned by
dbSNPrs1064793895
dbSNP (old)rs1064793895
ClinGenrs1064793895
ebirs1064793895
HLIrs1064793895
Exacrs1064793895
Gnomadrs1064793895
Varsomers1064793895
Maprs1064793895
PheGenIrs1064793895
Biobankrs1064793895
1000 genomesrs1064793895
hgdprs1064793895
ensemblrs1064793895
gopubmedrs1064793895
geneviewrs1064793895
scholarrs1064793895
googlers1064793895
pharmgkbrs1064793895
gwascentralrs1064793895
openSNPrs1064793895
23andMers1064793895
23andMe allrs1064793895
SNPshotrs1064793895
SNPdbers1064793895
MSV3drs1064793895
GWAS Ctlgrs1064793895
Max Magnitude0
ClinVar
Risk rs1064793895(GGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA;GGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA)
Alt rs1064793895(GGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA;GGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA)
Reference Rs1064793895(-;-)
Significance Pathogenic
Disease not provided Hereditary cancer-predisposing syndrome
Variation info
Gene FBXO11 MSH6
CLNDBN not provided Hereditary cancer-predisposing syndrome
Reversed 0
HGVS NC_000002.11:g.48033686_48033720dup35
CLNSRC
CLNACC RCV000478927.1, RCV000491494.1,