Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064794237

From SNPedia

ClinVar
Risk rs1064794237(CA;CA)
Alt rs1064794237(CA;CA)
Reference Rs1064794237(TGTATTAAGGACATTCTCAC;TGTATTAAGGACATTCTCAC)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene C11orf65 ATM
CLNDBN not provided
Reversed 0
HGVS NC_000011.9:g.108196200_108196219del20insCA
CLNSRC
CLNACC RCV000481474.1,