Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064794690

From SNPedia
ClinVar
Risk rs1064794690(-;-)
Alt rs1064794690(-;-)
Reference Rs1064794690(TATGTAAAGCAGTTGAAAATTA;TATGTAAAGCAGTTGAAAATTA)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene C11orf65 ATM
CLNDBN not provided
Reversed 0
HGVS NC_000011.9:g.108201024_108201045del22
CLNSRC
CLNACC RCV000482167.1,