Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064794823

From SNPedia
Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Chromosome1
Position244863736
is asnp
is mentioned by
dbSNPrs1064794823
dbSNP (old)rs1064794823
ClinGenrs1064794823
ebirs1064794823
HLIrs1064794823
Exacrs1064794823
Gnomadrs1064794823
Varsomers1064794823
Maprs1064794823
PheGenIrs1064794823
Biobankrs1064794823
1000 genomesrs1064794823
hgdprs1064794823
ensemblrs1064794823
gopubmedrs1064794823
geneviewrs1064794823
scholarrs1064794823
googlers1064794823
pharmgkbrs1064794823
gwascentralrs1064794823
openSNPrs1064794823
23andMers1064794823
23andMe allrs1064794823
SNPshotrs1064794823
SNPdbers1064794823
MSV3drs1064794823
GWAS Ctlgrs1064794823
Max Magnitude0
ClinVar
Risk rs1064794823(GCGGGGAAGAGCAGCGGCCCCA;GCGGGGAAGAGCAGCGGCCCCA)
Alt rs1064794823(GCGGGGAAGAGCAGCGGCCCCA;GCGGGGAAGAGCAGCGGCCCCA)
Reference Rs1064794823(-;-)
Significance Pathogenic
Disease not provided
Variation info
Gene
CLNDBN not provided
Reversed 1
HGVS NC_000001.10:g.245027038_245027039insTGGGGCCGCTGCTCTTCCCCGC
CLNSRC
CLNACC RCV000478096.1,