Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064795060

From SNPedia

ClinVar
Risk rs1064795060(-;-)
Alt rs1064795060(-;-)
Reference Rs1064795060(TCAGCTGGGATCGTGTTTTCCAGAGT;TCAGCTGGGATCGTGTTTTCCAGAGT)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene RARS2
CLNDBN not provided
Reversed 1
HGVS NC_000006.11:g.88228398_88228423del26
CLNSRC
CLNACC RCV000483947.1,