Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064795787

From SNPedia

ClinVar
Risk rs1064795787(-;-)
Alt rs1064795787(-;-)
Reference Rs1064795787(CAAGGTGAGCCCCAGGGTGGGGG;CAAGGTGAGCCCCAGGGTGGGGG)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene COQ8A ADCK3
CLNDBN not provided
Reversed 0
HGVS NC_000001.10:g.227172355_227172377del23
CLNSRC
CLNACC RCV000484631.1,