Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064795884

From SNPedia
ClinVar
Risk rs1064795884(-;-)
Alt rs1064795884(-;-)
Reference Rs1064795884(GAATGCCAGAGATATACAGGATATGC;GAATGCCAGAGATATACAGGATATGC)
Significance Pathogenic
Disease not provided
Variation info
Gene BRCA2
CLNDBN not provided
Reversed 0
HGVS NC_000013.10:g.32930588_32930613del26
CLNSRC
CLNACC RCV000481992.1,