Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064796014

From SNPedia

ClinVar
Risk rs1064796014(TTGCTTGAGATTAAGCCTGAGATTAAGG;TTGCTTGAGATTAAGCCTGAGATTAAGG)
Alt rs1064796014(TTGCTTGAGATTAAGCCTGAGATTAAGG;TTGCTTGAGATTAAGCCTGAGATTAAGG)
Reference Rs1064796014(CGAAGCCTGAACCTTCT;CGAAGCCTGAACCTTCT)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene HLCS
CLNDBN not provided
Reversed 1
HGVS NC_000021.8:g.38309601_38309617del17insCCTTAATCTCAGGCTTAATCTCAAGCAA
CLNSRC
CLNACC RCV000479512.1,