Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064796266

From SNPedia

ClinVar
Risk rs1064796266(CCCTG;CCCTG)
Alt rs1064796266(CCCTG;CCCTG)
Reference Rs1064796266(GGCTCGCGGACGTGAAGGGC;GGCTCGCGGACGTGAAGGGC)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene
CLNDBN not provided
Reversed 0
HGVS NC_000004.11:g.1808975_1808994del20insCCCTG
CLNSRC
CLNACC RCV000479750.1,