Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064796266(GGCTCGCGGACGTGAAGGGC;GGCTCGCGGACGTGAAGGGC)

From SNPedia
common in clinvar
Is agenotype
ofrs1064796266
Gene
Chromosome4
Position1,807,248
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(GGCTCGCGGACGTGAAGGGC;GGCTCGCGGACGTGAAGGGC) 0 common in clinvar