Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064796289

From SNPedia
ClinVar
Risk rs1064796289(-;-)
Alt rs1064796289(-;-)
Reference Rs1064796289(GGCAGCAGGTGATGGGGCAGG;GGCAGCAGGTGATGGGGCAGG)
Significance Pathogenic
Disease not provided
Variation info
Gene KANSL1
CLNDBN not provided
Reversed 1
HGVS NC_000017.10:g.44110433_44110453del21
CLNSRC
CLNACC RCV000483106.1,