Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064797104

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
ChromosomeX
Position154031053
is asnp
is mentioned by
dbSNPrs1064797104
dbSNP (old)rs1064797104
ClinGenrs1064797104
ebirs1064797104
HLIrs1064797104
Exacrs1064797104
Gnomadrs1064797104
Varsomers1064797104
Maprs1064797104
PheGenIrs1064797104
Biobankrs1064797104
1000 genomesrs1064797104
hgdprs1064797104
ensemblrs1064797104
gopubmedrs1064797104
geneviewrs1064797104
scholarrs1064797104
googlers1064797104
pharmgkbrs1064797104
gwascentralrs1064797104
openSNPrs1064797104
23andMers1064797104
23andMe allrs1064797104
SNPshotrs1064797104
SNPdbers1064797104
MSV3drs1064797104
GWAS Ctlgrs1064797104
Max Magnitude0
ClinVar
Risk rs1064797104(CCCCGGCAGGAAGCGAAAAGCTGAG;CCCCGGCAGGAAGCGAAAAGCTGAG)
Alt rs1064797104(CCCCGGCAGGAAGCGAAAAGCTGAG;CCCCGGCAGGAAGCGAAAAGCTGAG)
Reference Rs1064797104(-;-)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296505_153296529dup
CLNSRC
CLNACC RCV000488216.1,