Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064797278

From SNPedia
Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Chromosome2
Position181538227
GeneCERKL, ITGA4
is asnp
is mentioned by
dbSNPrs1064797278
dbSNP (old)rs1064797278
ClinGenrs1064797278
ebirs1064797278
HLIrs1064797278
Exacrs1064797278
Gnomadrs1064797278
Varsomers1064797278
Maprs1064797278
PheGenIrs1064797278
Biobankrs1064797278
1000 genomesrs1064797278
hgdprs1064797278
ensemblrs1064797278
gopubmedrs1064797278
geneviewrs1064797278
scholarrs1064797278
googlers1064797278
pharmgkbrs1064797278
gwascentralrs1064797278
openSNPrs1064797278
23andMers1064797278
23andMe allrs1064797278
SNPshotrs1064797278
SNPdbers1064797278
MSV3drs1064797278
GWAS Ctlgrs1064797278
Max Magnitude0
ClinVar
Risk rs1064797278(CCAAGACTTATCAGTCTTTA;CCAAGACTTATCAGTCTTTA)
Alt rs1064797278(CCAAGACTTATCAGTCTTTA;CCAAGACTTATCAGTCTTTA)
Reference Rs1064797278(-;-)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene CERKL ITGA4
CLNDBN not provided
Reversed 1
HGVS NC_000002.11:g.182402954_182402955insTAAGTCTTGGTAAAGACTGA
CLNSRC
CLNACC RCV000487537.1,