Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1085307692

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Chromosome6
Position36295409
GenePNPLA1
is asnp
is mentioned by
dbSNPrs1085307692
dbSNP (old)rs1085307692
ClinGenrs1085307692
ebirs1085307692
HLIrs1085307692
Exacrs1085307692
Gnomadrs1085307692
Varsomers1085307692
Maprs1085307692
PheGenIrs1085307692
Biobankrs1085307692
1000 genomesrs1085307692
hgdprs1085307692
ensemblrs1085307692
gopubmedrs1085307692
geneviewrs1085307692
scholarrs1085307692
googlers1085307692
pharmgkbrs1085307692
gwascentralrs1085307692
openSNPrs1085307692
23andMers1085307692
23andMe allrs1085307692
SNPshotrs1085307692
SNPdbers1085307692
MSV3drs1085307692
GWAS Ctlgrs1085307692
Max Magnitude0
ClinVar
Risk rs1085307692(GTACGAGGATGCAGTTTTGT;GTACGAGGATGCAGTTTTGT)
Alt rs1085307692(GTACGAGGATGCAGTTTTGT;GTACGAGGATGCAGTTTTGT)
Reference Rs1085307692(-;-)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene PNPLA1
CLNDBN not provided
Reversed 0
HGVS NC_000006.11:g.36263167_36263186dup
CLNSRC
CLNACC RCV000489756.1,