Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia
Cystic Fibrosis related
Geno Mag Summary
(-;AGGGAGAATGATGATGAAGTAC) 3 carrier of a cystic fibrosis allele

Make rs121908804(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
dbSNP (old)rs121908804
1000 genomesrs121908804
23andMe allrs121908804
GWAS Ctlgrs121908804
Max Magnitude3

Cystic fibrosis; c.720_741delAGGGAGAATGATGATGAAGTAC or Gly241Glufs

Risk rs121908804(-;-)
Alt rs121908804(-;-)
Significance Pathogenic
Disease Cystic fibrosis
Variation info
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117175442_117175463del22
CLNSRC OMIM Allelic Variant
CLNACC RCV000007565.6,