Have data from 23andMe or Ancestry? Make a report automatically with Promethease !


From SNPedia
common in clinvar
Is agenotype
Geno Mag Summary
(-;AGGGAGAATGATGATGAAGTAC) 3 carrier of a cystic fibrosis allele