Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs193302853(-;-)

From SNPedia
(Redirected from Rs193302853(D;D))
Mucolipidosis III gamma
Is agenotype
ofrs193302853
GeneGNPTG
Chromosome16
Position1,362,562
mentionedby
Magnitude6.1
ReputeBad
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;A) 3 Carrier of a mucolipidosis III gamma mutation
(GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC;GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC) 0 common in clinvar

See ClinVar sidebar on main rs/page for details.