Have questions? Visit https://www.reddit.com/r/SNPedia

rs193302853(-;A)

From SNPedia
(Redirected from Rs193302853(D;I))
Carrier of a mucolipidosis III gamma mutation
Is agenotype
ofrs193302853
GeneGNPTG
Chromosome16
Position1,362,562
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;A) 3 Carrier of a mucolipidosis III gamma mutation
(GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC;GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC) 0 common in clinvar

Unaffected in absence of a second mutation in the GNPTG gene; see ClinVar sidebar for links.