Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs193302859(-;GAGGATGCTGGCTACTTAAAGACCCCAG)

From SNPedia
(Redirected from Rs193302859(D;I))
Carrier of a mucolipidosis III gamma mutation
Is agenotype
ofrs193302859
GeneGNPTG
Chromosome16
Position1,362,641
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;GAGGATGCTGGCTACTTAAAGACCCCAG) 3 Carrier of a mucolipidosis III gamma mutation
(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG) 0 common in clinvar

Unaffected in absence of a second mutation in the GNPTG gene; see ClinVar sidebar for links.