Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922274

From SNPedia

ClinVar
Risk rs193922274(TTACA;TTACA)
Alt rs193922274(TTACA;TTACA)
Reference Rs193922274(GTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGGGCGCGGCCCTGGTCTC;GTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGGGCGCGGCCCTGGTCTC)
Significance Probable-Pathogenic
Disease Maturity-onset diabetes of the young
Variation info
Gene GCK
CLNDBN Maturity-onset diabetes of the young, type 2
Reversed 1
HGVS NC_000007.13:g.44184775_44184854del80insTGTAA
CLNSRC ClinVar
CLNACC RCV000029853.1,