Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs199422282

From SNPedia

ClinVar
Risk
Alt
Reference Rs199422282(ACGGAGCGAGTCCCCGCGCGCGGCGCGATTCCCTGAGC;ACGGAGCGAGTCCCCGCGCGCGGCGCGATTCCCTGAGC)
Significance Untested
Disease
Variation info
Gene TERC
CLNDBN
Reversed 1
HGVS NC_000003.11:g.169482434_169482471del38
CLNSRC
CLNACC