Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs199473693

From SNPedia

ClinVar
Risk rs199473693(-;-) Rs199473693(CAGAGCCCAGGCCTCTGGCA;CAGAGCCCAGGCCTCTGGCA)
Alt rs199473693(-;-) Rs199473693(CAGAGCCCAGGCCTCTGGCA;CAGAGCCCAGGCCTCTGGCA)
Reference Rs199473693(AGGCCTCTGGCACAGAGCCC;AGGCCTCTGGCACAGAGCCC)
Significance Pathogenic
Disease Ectopia lentis et pupillae Ectopia lentis not provided
Variation info
Gene LOC100289061 ADAMTSL4
CLNDBN Ectopia lentis et pupillae Ectopia lentis, isolated autosomal recessive not provided
Reversed 0
HGVS NC_000001.10:g.150526234_150526253del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000032753.4, RCV000032754.5, RCV000336254.2,