Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs267608327

From SNPedia

ClinVar
Risk rs267608327(-;-)
Alt rs267608327(-;-)
Reference Rs267608327(TGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC;TGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC)
Significance Pathogenic
Disease not provided Rett syndrome Mental retardation Autism
Variation info
Gene MECP2
CLNDBN not provided Rett syndrome Mental retardation, X-linked, syndromic 13 Autism, susceptibility to, X-linked 3
Reversed 1
HGVS NC_000023.10:g.153296082_153296122del41
CLNSRC Children's Hospital of Eastern Ontario
CLNACC RCV000132895.3, RCV000168701.5, RCV000169930.1, RCV000170099.1,