Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs267608593

From SNPedia

ClinVar
Risk rs267608593(-;-)
Alt rs267608593(-;-)
Reference Rs267608593(CCCCACCTCCACCTGAGCCCGAGAGCTCC;CCCCACCTCCACCTGAGCCCGAGAGCTCC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296091_153296119del29
CLNSRC
CLNACC RCV000132912.2,