Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia
(Redirected from Rs63750523(;))
common in clinvar
Is agenotype
Geno Mag Summary
(-;-) 0 common in clinvar
(-;AATAGCAAATGCAGTTGTTAAAGAACTTG) 6 Lynch syndrome, pathogenic mutation