Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;-) 6.3 Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
(-;GCACCAAGACTACAGTGATTGTCGG) 3 Carrier of a partial 17-alpha-hydroxylase/17,20-lyase deficiency mutation
ReferenceGRCh38.p2 38.2/146
is asnp
is mentioned by
dbSNP (old)rs786205062
1000 genomesrs786205062
23andMe allrs786205062
GWAS Ctlgrs786205062
Max Magnitude6.3
Risk Rs786205062(-;-)
Alt Rs786205062(-;-)
Significance Pathogenic
Disease Combined partial 17-alpha-hydroxylase/17
Variation info
Gene CYP17A1
CLNDBN Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
Reversed 1
HGVS NC_000010.10:g.104596889_104596913del25
CLNSRC OMIM Allelic Variant
CLNACC RCV000001868.6,