Have questions? Visit https://www.reddit.com/r/SNPedia

rs794728100

From SNPedia
ClinVar
Risk rs794728100(ATTCTATTGTTGTGCTATTGTTAT;ATTCTATTGTTGTGCTATTGTTAT)
Alt rs794728100(ATTCTATTGTTGTGCTATTGTTAT;ATTCTATTGTTGTGCTATTGTTAT)
Reference Rs794728100(TA;TA)
Significance Pathogenic
Disease Cardiomyopathy
Variation info
Gene DSG2
CLNDBN Cardiomyopathy
Reversed 0
HGVS NC_000018.9:g.29099770_29099771delTAinsATTCTATTGTTGTGCTATTGTTAT
CLNSRC
CLNACC RCV000181253.1,