Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;-) 0 common in clinvar
(-;TGGCACTGACCCGAGACTCTGAGCG) 3 Unaffected carrier of one bad argininosuccinate lyase allele
ReferenceGRCh38.p2 38.2/146
is asnp
is mentioned by
dbSNP (classic)rs796051932
1000 genomesrs796051932
23andMe allrs796051932
GWAS Ctlgrs796051932
Max Magnitude8

c.533_557dup25, p.Leu187Glyfs

Reference Rs796051932(-;-)
Significance Pathogenic
Disease not provided
Variation info
Gene ASL
CLNDBN not provided
Reversed 0
HGVS NC_000007.13:g.65551739_65551763dup25
CLNACC RCV000185779.1,