rs80359874
From SNPedia
Orientation | minus |
Stabilized | minus |
Geno | Mag | Summary |
---|---|---|
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 6 | BRCA1 variant considered pathogenic for breast cancer |
(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 0 | Normal |
Make rs80359874(-;-) |
Reference | GRCh38 38.1/141 |
Chromosome | 17 |
Position | 43094317 |
Gene | BRCA1 |
is a | snp |
is | mentioned by |
dbSNP | rs80359874 |
dbSNP (classic) | rs80359874 |
ClinGen | rs80359874 |
ebi | rs80359874 |
HLI | rs80359874 |
Exac | rs80359874 |
Gnomad | rs80359874 |
Varsome | rs80359874 |
LitVar | rs80359874 |
Map | rs80359874 |
PheGenI | rs80359874 |
Biobank | rs80359874 |
1000 genomes | rs80359874 |
hgdp | rs80359874 |
ensembl | rs80359874 |
geneview | rs80359874 |
scholar | rs80359874 |
rs80359874 | |
pharmgkb | rs80359874 |
gwascentral | rs80359874 |
openSNP | rs80359874 |
23andMe | rs80359874 |
SNPshot | rs80359874 |
SNPdbe | rs80359874 |
MSV3d | rs80359874 |
GWAS Ctlg | rs80359874 |
Max Magnitude | 6 |
rs80359874, also known as 1294del40, c.1175_1214del and p.Leu392_Ser405?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar | |
---|---|
Risk | rs80359874(-;-) |
Alt | rs80359874(-;-) |
Reference | Rs80359874(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) |
Significance | Pathogenic |
Disease | Breast-ovarian cancer Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified |
Variation | info |
Gene | BRCA1 |
CLNDBN | Breast-ovarian cancer, familial 1 Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified |
Reversed | 1 |
HGVS | NC_000017.10:g.41246334_41246373del40 |
CLNSRC | Breast Cancer Information Core (BRCA1) OMIM Allelic Variant |
CLNACC | RCV000019234.15, RCV000047372.6, RCV000131965.3, RCV000159899.3, RCV000238898.1, |