Have questions? Visit https://www.reddit.com/r/SNPedia

SL10030 490

From SNPedia

SL10030 490
Plant Solanaceae
SNP name SL10030_490
UCD contig 18264438
GenBank ID BM412808
Primer SL10030
Product size 1250
Forward Primer TCGCCAGTCACGATATACAGA
tmF 59.31
Reverse Primer AGCAGAAAGTGCAAGGATGG
tmR 60.40
Position 490
5prime Flanking sequence ACTATCCTCCCGGAATTTCATATTTACACA
Base1 A
Base2 C
3prime Flanking Sequence TCAACAGATATTGTGATAATCAGATTGGAT


This data is based on a pubmed paper [PMID 18088428]. That paper included an Excel file that identified approximately 1500 snps in a format which could be bulk imported.