Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

is agene
is mentioned by
Full namesolute carrier family 18 (vesicular monoamine), member 2
Other namesVMAT2
# SNPs6
 Max MagnitudeChromosome positionSummary

[PMID 16339215] identified 6 SLC18A2 promoter variants (listed below w/ position listed relative to the start of transcription [ch10:118,990,624 - human genome release may 2004], the haplotypes associated with increased transcriptional activity over the reference (no variants) were associated with lower observed Parkinson's disease risk

variant name dbSNP rs# variation position sequence context freq AA freq CAU freq notes
VMAT.1 none G/T -219 CTCTTCCCCAGGCCTGGGTCC 0.01 0.01 0.00 no noted effects, haplotype consisted only of .1
VMAT.2 none G/A -112 CAGCGACGGCGCGGGCGGGCG 0.01 0.01 0.00 .4 + .2 haplotype, no noted effects
VMAT.3 rs60912143 G/A -106 CGGCGCGGGCGGGCGGAGGCC 0.10 0.16 0.04 .4 + .3 denoted the only reduced (~50%) transcription haplotype observed
VMAT.4 none C/A -103 CGCGGGCGGGCGGAGGCCGGG 0.47 0.61 0.32 .4 haplotype, increased (~120%) transcriptional activity
VMAT.5 rs12412905 C/T -74 GCCCCCCGCCCCCGCTCCCTC 0.05 0.06 0.04 .5 + .4 haplotype, highest observed (~140%) transcription haplotype
VMAT.6 rs60543597 G/A -62 CGCTCCCTCCGGCCGTGACGT 0.15 0.07 0.23 .6 + .4 haplotype, higher (~130%) transcription haplotype