Have questions? Visit https://www.reddit.com/r/SNPedia

i3003626

From SNPedia

23andMe dataI3003626
23andMe searchI3003626
opensnpI3003626
Gene (via rs)CCR5, LOC102724297
GeneCCR5
Chromosome3
Position46414947
iGeno Mag Summary
(D;D) 5 resistant to HIV
(D;I) 2
(I;I) 0

aliasrs333
Rs_StabilizedOrientationplus
RsGeno Mag Summary
(-;-) 4 very resistant to HIV
(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) 2 resistant to HIV
(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) 0 common form

The public name for this SNP is rs333, and it is most commonly known as the CCR5 Delta32 (or 'Delta 32') mutation.

It is discussed in numerous articles and blogs, including here and here.

  • II +/+: Not resistant to HIV infection; shows average time of progression to AIDS after infection.
  • DI Delta32/+: Not resistant to HIV infection but may have slower progression to AIDS after infection.
  • DD Delta32/Delta32: Resistant to infection by the most common strain of HIV people usually encounter, though protection is not complete.


Resistance to HIV/AIDS