Rs333
From SNPedia
| is a | snp |
| is | mentioned by |
| dbSNP | rs333 |
| hapmap | rs333 |
| hgdp | rs333 |
| ensembl | rs333 |
| gopubmed | rs333 |
| scholar | rs333 |
| rs333 | |
| pharmgkb | rs333 |
| hgvbaseg2p | rs333 |
| medrefsnp | rs333 |
| 23andMe | rs333 |
| SNP Nexus |
| Gene | CCR5 |
| Chromosome | 3 |
| Orientation | plus |
| Position | 46389950 |
| Genotype | Effect |
|---|---|
| rs333(-;-) | very resistant to HIV |
| rs333(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | resistant to HIV |
| rs333(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | common form |
| Genotypes | Magnitude | Summary |
|---|---|---|
| Rs333(-;-) | very resistant to HIV | |
| Rs333(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | resistant to HIV | |
| Rs333(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | common form |
The chemokine receptor gene CCR5 plays an important role in many immune-related processes. rs333, the SNP designating the 'Delta 32' deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of CCR5.
Individuals carrying one copy of the Delta 32 SNP are somewhat resistant to infection by HIV, the virus that causes AIDS, and individuals with 2 copies (ie Delta 32 homozygotes; ~1% of Caucasians) are almost completely immune to infection by HIV. [PMID 8898752]
NEJM suggests decreased risk of type 1 diabetes (odds ratio, 0.54; 95% CI, 0.40 to 0.72; P=1.88x10–6 with 2 df).
Is Delta 32 a SNP with an entirely positive/protective role?
Probably not. In patients with abdominal aortic aneuryms (AAA's), the major risk is a sudden rupture - which is quite often fatal. Individuals with Delta 32 variants are more likely to have aneurysms than non-carriers, and among patients with aneurysms, Delta 32 carriers are more likely to rupture than to be caught in time to surgically repair. [PMID 15557916]
This is interesting for being of high medical interest, but probably requires full genomic sequence for detection.
See also I3003626
| PharmGKB | PA162360003 |
| Name | CCR5: 554_585del32, ?32, delta32 |
| Annotation | This variant (CCR5delta32 mutation) is associated with slower HIV disease progression in untreated patients. Heterozygous carriers tend to have lower rates of virological failure than patients with the common allele, but this benefit may not extend to the long term. Most reports indicated a favorable response to antiretroviral therapy for allele carriers. |
| Gene | CCR5 |
| Featue | |
| Evidence | PubMed ID:10463706; PubMed ID:10839590; PubMed ID:12447757; PubMed ID:15236615; PubMed ID:16312181 |
| Drugs | |
| Diseases | HIV, HIV Infections |
| Curation Level | Curated |
