Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886391

From SNPedia

ClinVar
Risk rs104886391(;)
Alt rs104886391(;)
Reference rs104886391(TCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTC;TCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTC)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107911601_107911672del72
CLNSRC ClinVar
CLNACC RCV000021544.1,


[PMID 11462238] Detection of mutations in the COL4A5 gene by SSCP in X-linked Alport syndrome.