Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922563

From SNPedia

ClinVar
Risk
Alt
Reference Rs193922563(TGGTCTATTTTCCCACCCTTAGGCT;TGGTCTATTTTCCCACCCTTAGGCT)
Significance Pathogenic
Disease beta^0^ Thalassemia Beta Thalassemia
Variation info
Gene HBB
CLNDBN beta^0^ Thalassemia beta Thalassemia
Reversed 1
HGVS NC_000011.9:g.5248027_5248051del25
CLNSRC HBVAR OMIM Allelic Variant
CLNACC RCV000016700.26, RCV000030009.1,