Have questions? Visit https://www.reddit.com/r/SNPedia

rs386134271

From SNPedia

ClinVar
Risk rs386134271(CCA;CCA)
Alt rs386134271(CCA;CCA)
Reference rs386134271(GCCCCCACCTCCACCTGAGCCCGAGAGCT;GCCCCCACCTCCACCTGAGCCCGAGAGCT)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296093_153296121del29insTGG
CLNSRC
CLNACC RCV000132900.2,