Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508445

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;ACATTCTGTTCTTCAAGCACCTATGTCAACCC) 3 carrier of a cystic fibrosis allele
(ACATTCTGTTCTTCAAGCACCTATGTCAACCC;ACATTCTGTTCTTCAAGCACCTATGTCAACCC) 0 common in clinvar


Make rs397508445(-;-)
ReferenceGRCh38 38.1/141
Chromosome7
Position117603733
GeneCFTR
is asnp
is mentioned by
dbSNPrs397508445
ebirs397508445
HLIrs397508445
Exacrs397508445
Varsomers397508445
Maprs397508445
PheGenIrs397508445
hapmaprs397508445
1000 genomesrs397508445
hgdprs397508445
ensemblrs397508445
gopubmedrs397508445
geneviewrs397508445
scholarrs397508445
googlers397508445
pharmgkbrs397508445
gwascentralrs397508445
openSNPrs397508445
23andMers397508445
23andMe allrs397508445
SNP Nexus

SNPshotrs397508445
SNPdbers397508445
MSV3drs397508445
GWAS Ctlgrs397508445
Max Magnitude3
ClinVar
Risk rs397508445(;)
Alt rs397508445(;)
Reference rs397508445(ACATTCTGTTCTTCAAGCACCTATGTCAACCC;ACATTCTGTTCTTCAAGCACCTATGTCAACCC)
Significance Pathogenic
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117243787_117243818del32
CLNSRC CFTR2
CLNACC RCV000046704.3,