Have questions? Visit https://www.reddit.com/r/SNPedia

rs397517305

From SNPedia

ClinVar
Risk rs397517305(;)
Alt rs397517305(;)
Reference rs397517305(GGCCATCCCACTGGACTACGA;GGCCATCCCACTGGACTACGA)
Significance Probable-Pathogenic
Disease Deafness
Variation info
Gene CDH23
CLNDBN Deafness, autosomal recessive 12
Reversed 0
HGVS NC_000010.10:g.73405693_73405713del21
CLNSRC
CLNACC RCV000150273.1,