Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776711

From SNPedia

ClinVar
Risk rs587776711(;)
Alt rs587776711(;)
Reference rs587776711(GCGTCGTCCCCTCGGCTGACCTC;GCGTCGTCCCCTCGGCTGACCTC)
Significance Pathogenic
Disease Pituitary hormone deficiency
Variation info
Gene LHX3
CLNDBN Pituitary hormone deficiency, combined 3
Reversed 0
HGVS NC_000009.11:g.139091504_139091526del23
CLNSRC OMIM Allelic Variant
CLNACC RCV000009588.5,