Have questions? Visit https://www.reddit.com/r/SNPedia

rs587780024

From SNPedia

ClinVar
Risk rs587780024(TGAACAGGAAGAAAAGTATG;TGAACAGGAAGAAAAGTATG)
Alt rs587780024(TGAACAGGAAGAAAAGTATG;TGAACAGGAAGAAAAGTATG)
Reference rs587780024(;)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome Familial cancer of breast
Variation info
Gene BARD1
CLNDBN Hereditary cancer-predisposing syndrome Familial cancer of breast
Reversed 1
HGVS NC_000002.11:g.215595182_215595201dup20
CLNSRC
CLNACC RCV000115621.4, RCV000200198.2,