Have questions? Visit https://www.reddit.com/r/SNPedia

rs60538473

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(AGCGCGCGCGCGTCGACGTCG;AGCGCGCGCGCGTCGACGTCG) 0 common in clinvar
(CGCGCGCGCGTCGACGTCGAG;CGCGCGCGCGTCGACGTCGAG) 0 common in clinvar
Make rs60538473(-;-)
Make rs60538473(-;CGCGCGCGCGTCGACGTCGAG)
ReferenceGRCh38 38.1/141
Chromosome2
Position219418979
GeneDES
is asnp
is mentioned by
dbSNPrs60538473
ebirs60538473
HLIrs60538473
Exacrs60538473
Varsomers60538473
Maprs60538473
PheGenIrs60538473
hapmaprs60538473
1000 genomesrs60538473
hgdprs60538473
ensemblrs60538473
gopubmedrs60538473
geneviewrs60538473
scholarrs60538473
googlers60538473
pharmgkbrs60538473
gwascentralrs60538473
openSNPrs60538473
23andMers60538473
23andMe allrs60538473
SNP Nexus

SNPshotrs60538473
SNPdbers60538473
MSV3drs60538473
GWAS Ctlgrs60538473
Max Magnitude0
ClinVar
Risk rs60538473(;)
Alt rs60538473(;)
Reference rs60538473(AGCGCGCGCGCGTCGACGTCG;AGCGCGCGCGCGTCGACGTCG)
Significance Pathogenic
Disease Myofibrillar myopathy 1 not provided
Variation info
Gene DES
CLNDBN Myofibrillar myopathy 1 not provided
Reversed 0
HGVS NC_000002.11:g.220283701_220283721del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000018317.29, RCV000056803.1,