Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231139

From SNPedia

ClinVar
Risk rs606231139(TTG;TTG)
Alt rs606231139(TTG;TTG)
Reference rs606231139(AATCCCCTGTTGGGGGCCTCAC;AATCCCCTGTTGGGGGCCTCAC)
Significance Pathogenic
Disease Coenzyme Q10 deficiency
Variation info
Gene ADCK3
CLNDBN Coenzyme Q10 deficiency, primary, 4
Reversed 0
HGVS NC_000001.10:g.227153023_227153044del22insTTG
CLNSRC OMIM Allelic Variant
CLNACC RCV000003827.3,