Have questions? Visit https://www.reddit.com/r/SNPedia

rs757575602

From SNPedia

ClinVar
Risk rs757575602(;)
Alt rs757575602(;)
Reference rs757575602(TGAAAATGAAAAAACCGAGGGTACAAACC;TGAAAATGAAAAAACCGAGGGTACAAACC)
Significance Pathogenic
Disease Stromme syndrome
Variation info
Gene CENPF
CLNDBN Stromme syndrome
Reversed 0
HGVS NC_000001.10:g.214788183_214788211del29
CLNSRC OMIM Allelic Variant
CLNACC RCV000210068.1,