Have questions? Visit https://www.reddit.com/r/SNPedia

rs794728438

From SNPedia

ClinVar
Risk rs794728438(;)
Alt rs794728438(;)
Reference rs794728438(ATCGACATGGTGGCCGCCATCCCCTTC;ATCGACATGGTGGCCGCCATCCCCTTC)
Significance Pathogenic
Disease not provided
Variation info
Gene KCNH2
CLNDBN not provided
Reversed 1
HGVS NC_000007.13:g.150649546_150649572del27
CLNSRC
CLNACC RCV000181976.2,