Have questions? Visit https://www.reddit.com/r/SNPedia

rs796051932

From SNPedia

Orientationplus
Geno Mag Summary
(;) 0 common in clinvar
(-;TGGCACTGACCCGAGACTCTGAGCG) 3 Unaffected carrier of one bad argininosuccinate lyase allele
(TGGCACTGACCCGAGACTCTGAGCG;TGGCACTGACCCGAGACTCTGAGCG) 8 Argininosuccinate lyase deficiency


Make rs796051932(-;-)
ReferenceGRCh38.p2 38.2/146
Chromosome7
Position66086776
GeneASL
is asnp
is mentioned by
dbSNPrs796051932
ebirs796051932
HLIrs796051932
Exacrs796051932
Varsomers796051932
Maprs796051932
PheGenIrs796051932
hapmaprs796051932
1000 genomesrs796051932
hgdprs796051932
ensemblrs796051932
gopubmedrs796051932
geneviewrs796051932
scholarrs796051932
googlers796051932
pharmgkbrs796051932
gwascentralrs796051932
openSNPrs796051932
23andMers796051932
23andMe allrs796051932
SNP Nexus

SNPshotrs796051932
SNPdbers796051932
MSV3drs796051932
GWAS Ctlgrs796051932
Max Magnitude8

c.533_557dup25, p.Leu187Glyfs

ClinVar
Risk rs796051932(CGTGGCACTGACCCGAGACTCTGAG;CGTGGCACTGACCCGAGACTCTGAG)
Alt rs796051932(CGTGGCACTGACCCGAGACTCTGAG;CGTGGCACTGACCCGAGACTCTGAG)
Reference rs796051932(;)
Significance Pathogenic
Disease not provided
Variation info
Gene ASL
CLNDBN not provided
Reversed 0
HGVS NC_000007.13:g.65551739_65551763dup25
CLNSRC
CLNACC RCV000185779.1,