Have questions? Visit https://www.reddit.com/r/SNPedia

rs797044815

From SNPedia

ClinVar
Risk
Alt
Reference Rs797044815(GATGTGTTAAAGCATATAGCACA;GATGTGTTAAAGCATATAGCACA)
Significance Pathogenic
Disease Dent disease 1
Variation info
Gene CLCN5
CLNDBN Dent disease 1
Reversed 0
HGVS NC_000023.10:g.49856818_49856840del23
CLNSRC
CLNACC RCV000192282.1,